Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.139271 |
Chromosome: | chromosome 17 |
Location: | 634192 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g700300 | CGL22 | cdc48-like protein; (1 of 3) PF00004//PF07724 - ATPase family associated with various cellular activities (AAA) (AAA) // AAA domain (Cdc48 subfamily) (AAA_2) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGACGGCGGCGATGCTGTTGGTGCTAC |
Internal bar code: | AATCGGCACGATGTTCCTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 221 |
LEAP-Seq percent confirming: | 94.5446 |
LEAP-Seq n confirming: | 5979 |
LEAP-Seq n nonconfirming: | 345 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGCAGAGGAGCGAACACAT |
Suggested primer 2: | AACCGCATACCAACCCATTA |