| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.139290 |
| Chromosome: | chromosome 7 |
| Location: | 5186516 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g348550 | TGL13 | (1 of 3) PTHR21493:SF153 - PROTEIN T08B1.4, ISOFORM B-RELATED; Putative triacylglycerol lipase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTCGCCGTGACCTGTTTCTCTCACCTCA |
| Internal bar code: | TCGTCCTGTGTGGTGGTTGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 621 |
| LEAP-Seq percent confirming: | 99.8314 |
| LEAP-Seq n confirming: | 592 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGAAAGCTAACCCGCTTTG |
| Suggested primer 2: | ACATGTGGCCATTGTCAAGA |