Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.139296 |
Chromosome: | chromosome 10 |
Location: | 5587692 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g459900 | PFH4,PHX16,P4H4 | Prolyl 4-hydroxylase 4; (1 of 5) PTHR10869//PTHR10869:SF55 - PROLYL 4-HYDROXYLASE ALPHA SUBUNIT // OXOGLUTARATE/IRON-DEPENDENT OXYGENASE | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGCACACGCACGCACGCAGGTGTGGAGG |
Internal bar code: | CGGGTTAAATTCTCGGGGCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 690 |
LEAP-Seq percent confirming: | 53.291 |
LEAP-Seq n confirming: | 6299 |
LEAP-Seq n nonconfirming: | 5521 |
LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGCACCGATATCACAACAA |
Suggested primer 2: | TTACCCCAGGACAGATGAGC |