| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.139376 |
| Chromosome: | chromosome 13 |
| Location: | 4077175 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g591300 | (1 of 18) PTHR19862:SF14 - WD REPEAT-CONTAINING PROTEIN 48 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGGGACGGTCGGCTTGAAAGACGGGCC |
| Internal bar code: | GTAACACTACTGTCGGTCCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 195 |
| LEAP-Seq percent confirming: | 98.2483 |
| LEAP-Seq n confirming: | 1907 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCGGCTTTACTGCTGCTAT |
| Suggested primer 2: | AGGGAACTGCAACAGTGCTT |