| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.139384 |
| Chromosome: | chromosome 6 |
| Location: | 7001710 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g296700 | HYDG1,HYDG | Hydrogenase assembly factor/biotin synthase; (1 of 1) PTHR22976//PTHR22976:SF2 - BIOTIN SYNTHASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCTCACGCTTCCCCCACCTAGCGCTGCC |
| Internal bar code: | CACGCGACTCGGGGCAATGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 868 |
| LEAP-Seq percent confirming: | 97.8757 |
| LEAP-Seq n confirming: | 18522 |
| LEAP-Seq n nonconfirming: | 402 |
| LEAP-Seq n unique pos: | 103 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAGGTCAACCATTTGGCAG |
| Suggested primer 2: | GGTTGGGTTACACACGCTCT |