Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.139391 |
Chromosome: | chromosome 9 |
Location: | 3911309 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g392282 | DHC2 | Axonemal Dynein Heavy Chain 2; (1 of 1) PTHR10676:SF137 - DYNEIN HEAVY CHAIN 1, AXONEMAL | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCGACCTGCAGGTGGTGAGTAGCTACC |
Internal bar code: | CAAGTATAACAATAGGGCACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1245 |
LEAP-Seq percent confirming: | 99.5783 |
LEAP-Seq n confirming: | 30224 |
LEAP-Seq n nonconfirming: | 128 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACCCACACACAGGCGTAAA |
Suggested primer 2: | TGAACGTGGAGAGCTACGTG |