| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.139417 |
| Chromosome: | chromosome 4 |
| Location: | 2945690 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g224700 | NRT1 | (1 of 1) K14638 - solute carrier family 15 (peptide/histidine transporter), member 3/4 (SLC15A3_4, PHT); Nitrate transporter NRT1 family | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCAAATTTAACTAAACAAAACCAAGCTA |
| Internal bar code: | AGCTGACACCGTATGCGTAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 229 |
| LEAP-Seq percent confirming: | 99.2238 |
| LEAP-Seq n confirming: | 767 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAAAGTAAACCAAGCCAA |
| Suggested primer 2: | GGAGGGGAACCATTTCATTT |