| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.139426 |
| Chromosome: | chromosome 2 |
| Location: | 6505359 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g116500 | CPY3 | Serine carboxypeptidase; (1 of 1) PTHR11802:SF30 - PROTEIN Y16B4A.2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACACGAGGTGCCTTTCCAACATGCCCAAC |
| Internal bar code: | GCCTCTTTTGTGGCTCCCTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 376 |
| LEAP-Seq percent confirming: | 99.0853 |
| LEAP-Seq n confirming: | 11266 |
| LEAP-Seq n nonconfirming: | 104 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTAGTTTGCAAATCGCTGC |
| Suggested primer 2: | GGTTACGAGGAGCGCAATAA |