| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.139429 |
| Chromosome: | chromosome 6 |
| Location: | 1206616 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g257650 | MSRA2 | (1 of 2) PTHR10173//PTHR10173:SF34 - METHIONINE SULFOXIDE REDUCTASE // SUBFAMILY NOT NAMED; Peptide methionine-S-sulfoxide reductase, msrA-type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCTCCACGTGGCCCCCCGCGTAGCCGC |
| Internal bar code: | GGTCGGGCAATTGCAGCGACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 67 |
| LEAP-Seq percent confirming: | 10.4348 |
| LEAP-Seq n confirming: | 204 |
| LEAP-Seq n nonconfirming: | 1751 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCATAACGAGCAGGGAATA |
| Suggested primer 2: | CCAGGTGACTGATGTGATGG |