| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.139678 |
| Chromosome: | chromosome 13 |
| Location: | 1373547 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g571800 | (1 of 4) PF07059 - Protein of unknown function (DUF1336) (DUF1336) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATGTACCCCCGAGGTTACTCAGGCGGTC |
| Internal bar code: | GTCCGCATTAGGATGTGTGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1028 |
| LEAP-Seq percent confirming: | 99.6384 |
| LEAP-Seq n confirming: | 27277 |
| LEAP-Seq n nonconfirming: | 99 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGACGTAAGCTGAATGCTG |
| Suggested primer 2: | CACCACACCAGAACCTTCCT |