| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.139759 |
| Chromosome: | chromosome 7 |
| Location: | 4263140 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g341800 | CGL107 | possible transcription factor; (1 of 1) K02326 - DNA polymerase epsilon subunit 3 (POLE3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGACCTCGTTCAAGAAAGAGTGCCGCCGT |
| Internal bar code: | TCTATTCAGCCTTGGTAGCATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 653 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGTGCAAGTGGAGGACAT |
| Suggested primer 2: | GACAAGGACAGGACCGACAT |