| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.139797 |
| Chromosome: | chromosome 2 |
| Location: | 6435087 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g115750 | GPD9 | (1 of 2) PTHR23344:SF28 - GLYCEROPHOSPHODIESTER PHOSPHODIESTERASE 1; Glycerophosphoryl diester phosphodiesterase family protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCTCCCCGAAGTGGTGAACGCGGAACAT |
| Internal bar code: | AATGTGACAGTCGATGACCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 829 |
| LEAP-Seq percent confirming: | 99.7777 |
| LEAP-Seq n confirming: | 8079 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCGGGTGACTACTTGTGAT |
| Suggested primer 2: | GGGGTCAAAGTTGTTGTGCT |