| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.139826 |
| Chromosome: | chromosome 12 |
| Location: | 7261073 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g558100 | PRMT2,PRMT10,PRM2 | Protein-/Histone-arginine N-methyltransferase; (1 of 1) PTHR11006:SF68 - PROTEIN ARGININE N-METHYLTRANSFERASE PRMT10 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGAGCAGAGCAAAACGCCGCGCGAGTTC |
| Internal bar code: | CCCAGTATTCCCGTGTCACAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 971 |
| LEAP-Seq percent confirming: | 98.8856 |
| LEAP-Seq n confirming: | 18634 |
| LEAP-Seq n nonconfirming: | 210 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCAGGCTAGCTAACCCAT |
| Suggested primer 2: | ACGAGAACCCCACAGACAAC |