| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.139868 |
| Chromosome: | chromosome 10 |
| Location: | 2905160 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g440050 | CSP41A,Csp41a,SNE12,RAP41 | (1 of 1) PTHR10366//PTHR10366:SF278 - NAD DEPENDENT EPIMERASE/DEHYDRATASE // CHLOROPLAST STEM-LOOP BINDING PROTEIN OF 41 KDA A, CHLOROPLASTIC; Chloroplast stem-loop-binding protein 41a | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGATCAAGCGCACGGTGCTCCCCGCCAAC |
| Internal bar code: | TTGGAGTCCCAACAACGATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 775 |
| LEAP-Seq percent confirming: | 75.0565 |
| LEAP-Seq n confirming: | 1661 |
| LEAP-Seq n nonconfirming: | 552 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAAGGCAAACGTGAGTGC |
| Suggested primer 2: | ATTGTACGACGTAGGCCCTG |