Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.139887 |
Chromosome: | chromosome 7 |
Location: | 1429828 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g323000 | DP1,TDP1 | Transcription factor, E2F/dimerisation partner; (1 of 2) PTHR12548:SF9 - TRANSCRIPTION FACTOR DP | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCTCACAAACTGCGACTGCCTCTGCTGC |
Internal bar code: | CACCATCTAGCGCGTGGGAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 144 |
LEAP-Seq percent confirming: | 99.6463 |
LEAP-Seq n confirming: | 3381 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGACAGATGTCAGGGTCA |
Suggested primer 2: | TCTGTCCATGCTGTCAGAGG |