Insertion junction: LMJ.RY0402.139889_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.139889
Chromosome:chromosome_11
Location:2071916
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre11.g468850 FAP152 Flagellar Associated Protein antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GCCAGCCGCCGCATGCGCTCCTCAGCCAGC
Internal bar code:GGGGTGCGAACGGGAGGACTGC

Confirmation - LEAP-Seq

LEAP-Seq distance:944
LEAP-Seq percent confirming:99.7426
LEAP-Seq n confirming:6199
LEAP-Seq n nonconfirming:16
LEAP-Seq n unique pos:36

Suggested primers for confirmation by PCR

Suggested primer 1:TTTGTAGCGGTGATGTGCTC
Suggested primer 2:GTGCATCAACATGAACCCTG