Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.139930 |
Chromosome: | chromosome 1 |
Location: | 5013777 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g034600 | (1 of 1) PTHR22847:SF430 - MZB10.11 PROTEIN-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCACAGGTGCGTGTTAAGGCCGCGGTGT |
Internal bar code: | GACTTTTGCGGGCCCGTTATGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 374 |
LEAP-Seq percent confirming: | 86.2419 |
LEAP-Seq n confirming: | 7052 |
LEAP-Seq n nonconfirming: | 1125 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGTACGGCAATCCCATGTT |
Suggested primer 2: | GCTACCAATACACCCGCACT |