| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.140054 |
| Chromosome: | chromosome 7 |
| Location: | 3890693 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g339050 | NSG11 | Cofilin/tropomyosin-type actin-binding protein; (1 of 1) K05765 - cofilin (CFL) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTCAACAGAACAGCGCACCACACAGGTT |
| Internal bar code: | GGTCGAGTACGGTATCGATAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1310 |
| LEAP-Seq percent confirming: | 97.424 |
| LEAP-Seq n confirming: | 26247 |
| LEAP-Seq n nonconfirming: | 694 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACCATACCGTGCCTGTTC |
| Suggested primer 2: | CTCAGGGAGTCAGAACCTCG |