Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.140054 |
Chromosome: | chromosome 7 |
Location: | 3890727 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g339050 | NSG11 | Cofilin/tropomyosin-type actin-binding protein; (1 of 1) K05765 - cofilin (CFL) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGGATGGAGCTTGTTTGTTGAATGGGAT |
Internal bar code: | TCGCGCGAACTGCCTTTCGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 769 |
LEAP-Seq percent confirming: | 99.7649 |
LEAP-Seq n confirming: | 14002 |
LEAP-Seq n nonconfirming: | 33 |
LEAP-Seq n unique pos: | 107 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGACCATACCGTGCCTGTTC |
Suggested primer 2: | AGACTGGTGTGACCGGTAGG |