| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.140092 |
| Chromosome: | chromosome 12 |
| Location: | 5724905 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g532850 | PHR3 | (1 of 4) PF00497 - Bacterial extracellular solute-binding proteins, family 3 (SBP_bac_3); Putative photolyase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGGCACGAGCACCTTGGACACGCCGAT |
| Internal bar code: | AGTCCCCCCGGGAGTGGTGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1081 |
| LEAP-Seq percent confirming: | 99.6553 |
| LEAP-Seq n confirming: | 13301 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTTTATTGCTCACCACCCG |
| Suggested primer 2: | TCTTTCTTGAGCCCATCCAC |