Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.140129 |
Chromosome: | chromosome 5 |
Location: | 2301139 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g234700 | PYK3 | Pyruvate kinase 3; (1 of 2) PTHR11817:SF3 - PYRUVATE KINASE | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGAGAAGGTGAGTGGTGTTGGGACAGC |
Internal bar code: | CGGGGATACTGCGGGCGCGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 872 |
LEAP-Seq percent confirming: | 98.1424 |
LEAP-Seq n confirming: | 6657 |
LEAP-Seq n nonconfirming: | 126 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCGCTGGGGTTCTAACTTT |
Suggested primer 2: | GCCCCAGTATCTACGGAACA |