| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.140171 |
| Chromosome: | chromosome 11 |
| Location: | 2726544 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g477000 | SNRK2D | snRK1 family in Chlamydomonas, subgroup 2; (1 of 41) IPR000719//IPR011009 - Protein kinase domain // Protein kinase-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTGCTTCCACGCCCGGTGCCGGCGCATG |
| Internal bar code: | ATGGGATGGGGCGGTACACGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 872 |
| LEAP-Seq percent confirming: | 90.646 |
| LEAP-Seq n confirming: | 33452 |
| LEAP-Seq n nonconfirming: | 3452 |
| LEAP-Seq n unique pos: | 70 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATAGCTTCGAGGCGAATTG |
| Suggested primer 2: | TCTGGATTGCTTCTGCATTG |