| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.140182 |
| Chromosome: | chromosome 2 |
| Location: | 3420467 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095111 | VSR1 | Vacuolar Sorting Receptor; (1 of 1) PTHR22765//PTHR22765:SF56 - RING FINGER AND PROTEASE ASSOCIATED DOMAIN-CONTAINING // VACUOLAR-SORTING RECEPTOR 5-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGCTGGCGTCTTCGGGCACCTCTCCGG |
| Internal bar code: | CCTAGGTAGACGTCGGGGCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 257 |
| LEAP-Seq percent confirming: | 79.0535 |
| LEAP-Seq n confirming: | 13413 |
| LEAP-Seq n nonconfirming: | 3554 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACTTGTTCTCAAGAGGGC |
| Suggested primer 2: | TGGCTACGCCTTCACTTCTT |