| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.140224 |
| Chromosome: | chromosome 3 |
| Location: | 2930221 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g163150 | (1 of 2) K09955 - hypothetical protein (K09955) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTACGTCAGCGGGATGGGGATGGGGAGGT |
| Internal bar code: | TGTCGACCGTTGCCAACGGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 224 |
| LEAP-Seq percent confirming: | 92.3998 |
| LEAP-Seq n confirming: | 8644 |
| LEAP-Seq n nonconfirming: | 711 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGGTGGGTTAAAGGGAGG |
| Suggested primer 2: | AATGCAACTTAATCCGCACC |