Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.140240 |
Chromosome: | chromosome 16 |
Location: | 633939 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g691950 | (1 of 6) IPR006502//IPR011333 - Protein of unknown function PDDEXK-like // POZ domain | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCAAAATGTTCAACACACACGTTGCGTC |
Internal bar code: | CTGGTAGACCCACTGCCAGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 589 |
LEAP-Seq percent confirming: | 99.6695 |
LEAP-Seq n confirming: | 3921 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTGCCCTGCTAACTCCACT |
Suggested primer 2: | TTCTACTGCTGCATCAACGG |