| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.140245 |
| Chromosome: | chromosome 2 |
| Location: | 6008770 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g112300 | MOT15,CAL3 | Calpain family cysteine protease; (1 of 2) K08582 - calpain-15 [EC:3.4.22.-] (CAPN15) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTTCCAGTGGCCCCTCCTCACCATCTTG |
| Internal bar code: | TTTCCTGCCGGTCGGGCTACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 69 |
| LEAP-Seq percent confirming: | 99.7803 |
| LEAP-Seq n confirming: | 9992 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACGGTGCTGTCTTGCCTT |
| Suggested primer 2: | GAACAGGTCATGCTCTGCAA |