| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.140361 |
| Chromosome: | chromosome 16 |
| Location: | 5818086 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g677950 | QOR1 | (1 of 1) 1.1.1.54//1.3.1.102 - Allyl-alcohol dehydrogenase // 2-alkenal reductase (NADP(+)) / NADPH-dependent alkenal/one oxidoreductase; NADPH quinone oxidoreductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACCACAGCTTTTGGACCTGGACGAAGC |
| Internal bar code: | TAAGATGTGATTATGTCGGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 765 |
| LEAP-Seq percent confirming: | 99.2432 |
| LEAP-Seq n confirming: | 12196 |
| LEAP-Seq n nonconfirming: | 93 |
| LEAP-Seq n unique pos: | 75 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCATGCATATCCGAAAAC |
| Suggested primer 2: | TCGTTTGGTCAAGAGTGCAG |