Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.140362 |
Chromosome: | chromosome 3 |
Location: | 3427612 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g167150 | FMO1 | Flavin-containing monooxygenase; (1 of 2) PTHR23023//PTHR23023:SF4 - DIMETHYLANILINE MONOOXYGENASE // FLAVIN-CONTAINING MONOOXYGENASE | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTCCACTCGACTGCGCGACGTCCCTCGG |
Internal bar code: | TGTTCTGTTAGCGCCAACGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 908 |
LEAP-Seq percent confirming: | 95.2932 |
LEAP-Seq n confirming: | 8240 |
LEAP-Seq n nonconfirming: | 407 |
LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAAAAACGAGCCACTTAGC |
Suggested primer 2: | GAACCAACCCAGCATCAAGT |