| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.140375 |
| Chromosome: | chromosome 3 |
| Location: | 3413947 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g166950 | PGM5 | (1 of 1) K01834 - 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase (PGAM, gpmA); Phosphoglycerate mutase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCGGTGGGCACCCGAACATCACACAAAT |
| Internal bar code: | TCGAGAGAAGGGGGTTATAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 439 |
| LEAP-Seq percent confirming: | 99.2064 |
| LEAP-Seq n confirming: | 125 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAGCTTGGAAACTAGCGG |
| Suggested primer 2: | AGCTTCTTGTCCACACCCAG |