| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.140422 |
| Chromosome: | chromosome 5 |
| Location: | 763475 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g248550 | (1 of 1) K16276 - zinc finger protein-like protein (K16276, BTS) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGAGCTGAATGAGCGTGTGCTAGTCGAC |
| Internal bar code: | TTGTAATAGCGCAGGTAGCCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 664 |
| LEAP-Seq percent confirming: | 96.4471 |
| LEAP-Seq n confirming: | 3719 |
| LEAP-Seq n nonconfirming: | 137 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCATGACCCGATCCTGTA |
| Suggested primer 2: | GAATGTGTGTGTTTGCGGAC |