| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.140426 |
| Chromosome: | chromosome 3 |
| Location: | 2068150 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g156650 | (1 of 5) 2.7.11.7 - [Myosin heavy-chain] kinase / Myosin II heavy-chain kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATCGCCTGTGAGCTGCGCCAGTACGTCC |
| Internal bar code: | GGAGGTCAGTGCCCATCGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1008 |
| LEAP-Seq percent confirming: | 99.581 |
| LEAP-Seq n confirming: | 18540 |
| LEAP-Seq n nonconfirming: | 78 |
| LEAP-Seq n unique pos: | 94 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCTGGTGAGCATTTGTGA |
| Suggested primer 2: | CATGGACAGGAACAACAACG |