| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.140480 |
| Chromosome: | chromosome 8 |
| Location: | 1353522 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g364000 | FAP413 | Flagellar Associated Protein 413; (1 of 1) PTHR22847//PTHR22847:SF460 - WD40 REPEAT PROTEIN // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGTGTAGCCTTGTACTAACTGGCAGCAT |
| Internal bar code: | CTGGCAGGCACCAGCTTAATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 194 |
| LEAP-Seq percent confirming: | 96.2361 |
| LEAP-Seq n confirming: | 1125 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACATCGGAACCACACAGTC |
| Suggested primer 2: | GCAAGGCCAAGCTCTACATC |