| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.140497 |
| Chromosome: | chromosome 6 |
| Location: | 2166310 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g265950 | DHC3 | Axonemal Inner Arm Dynein Heavy Chain 3, pseudogene; (1 of 2) PTHR10676:SF136 - DYNEIN HEAVY CHAIN 6, AXONEMAL | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCGCTGTCGCTGTACGACGTGCACCCCG |
| Internal bar code: | ACAGGGTGTCCGTCATGTAGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 486 |
| LEAP-Seq percent confirming: | 64.1051 |
| LEAP-Seq n confirming: | 23174 |
| LEAP-Seq n nonconfirming: | 12976 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCTGTTCACCGACTCCTC |
| Suggested primer 2: | ACCCTCCACCAGGAACATCT |