| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.140532 |
| Chromosome: | chromosome 1 |
| Location: | 1446530 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g007300 | (1 of 1) 3.1.4.54 - N-acetylphosphatidylethanolamine-hydrolyzing phospholipase D / N-acyl phosphatidylethanolamine phospholipase D | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGATGCTAGGGTCAGCTGCACAGTATTTCA |
| Internal bar code: | GCCGCAGAGTCGGCGGGGGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 804 |
| LEAP-Seq percent confirming: | 98.9511 |
| LEAP-Seq n confirming: | 5566 |
| LEAP-Seq n nonconfirming: | 59 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGGTGCGGAGTGTATGAT |
| Suggested primer 2: | TCGACCATTGCAGTAGCTTG |