| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.140626 |
| Chromosome: | chromosome 9 |
| Location: | 482758 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g404250 | SRR29, CEP9,CEP9 | Cysteine endopeptidase; (1 of 1) PF00112//PF01476//PF07645 - Papain family cysteine protease (Peptidase_C1) // LysM domain (LysM) // Calcium-binding EGF domain (EGF_CA) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGCATGCGGGCGCAGTGCGGCAACGCCG |
| Internal bar code: | CTCTGCAACCGGCTCCCGGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 221 |
| LEAP-Seq percent confirming: | 98.0496 |
| LEAP-Seq n confirming: | 1860 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTCAGCAGCATCACTTGC |
| Suggested primer 2: | TGCACTCTATCCACTGCTGG |