| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.140655 |
| Chromosome: | chromosome 2 |
| Location: | 4964105 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g103950 | MIA1,FAP100 | (1 of 2) PF13863 - Domain of unknown function (DUF4200) (DUF4200); MIA1 subunit of the modifier of inner arms (MIA) complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTACGGGAGTAAAAGATTACCCCAGGTAC |
| Internal bar code: | TGCAGTACACGTGCAGGGTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 783 |
| LEAP-Seq percent confirming: | 87.1698 |
| LEAP-Seq n confirming: | 231 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAAGGGCTCAAATTGCTA |
| Suggested primer 2: | TGAGACACGATGAGAGGCAC |