Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.140668 |
Chromosome: | chromosome 4 |
Location: | 2594663 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g222650 | (1 of 18) PTHR19862//PTHR19862:SF14 - FAMILY NOT NAMED // WD REPEAT-CONTAINING PROTEIN 48 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCGTAACCGGGTGCCGTACGGCGACTCG |
Internal bar code: | TCCAGCTGCGGAACCTGCAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 601 |
LEAP-Seq percent confirming: | 95.5544 |
LEAP-Seq n confirming: | 54208 |
LEAP-Seq n nonconfirming: | 2522 |
LEAP-Seq n unique pos: | 103 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGACACTGCTGCTCCTCAG |
Suggested primer 2: | CCACACTGTCCACAATCGTC |