| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.140781 |
| Chromosome: | chromosome 5 |
| Location: | 207851 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234100 | CYP745A1,CYP17 | Cytochrome P450, CYP197 superfamily; (1 of 1) PTHR24305:SF59 - CYTOCHROME P450 313A1-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACAGGCTACTGGTGGCGCGGGAGGCCAG |
| Internal bar code: | GGCCCGCGTCCAGTGTATGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 406 |
| LEAP-Seq percent confirming: | 75.0943 |
| LEAP-Seq n confirming: | 995 |
| LEAP-Seq n nonconfirming: | 330 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCCGCCTGCTCACTCTAC |
| Suggested primer 2: | TTTGGTTTACTTTGGGCTGG |