| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.140860 |
| Chromosome: | chromosome 10 |
| Location: | 5647110 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g460400 | (1 of 1) PF00642//PF04564 - Zinc finger C-x8-C-x5-C-x3-H type (and similar) (zf-CCCH) // U-box domain (U-box) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCTTCTGCCATCAGCTCTACGGGACGGC |
| Internal bar code: | ATGCCCAACCCGTTTTCCGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 735 |
| LEAP-Seq percent confirming: | 99.3743 |
| LEAP-Seq n confirming: | 10799 |
| LEAP-Seq n nonconfirming: | 68 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTCTACACAGCTCATCCG |
| Suggested primer 2: | CTGATGGTGTGTCATCCTGG |