| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.141017 |
| Chromosome: | chromosome 2 |
| Location: | 2435764 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g091550 | WHI,EZY18,PBF2 | (1 of 1) PTHR31745:SF1 - SINGLE-STRANDED DNA-BINDING PROTEIN WHY2, MITOCHONDRIAL; Whirly domain protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTCTCCGTCCCTTTCACCCCAGGTCCTG |
| Internal bar code: | GCGCTAAGAGGACGAAGTTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 509 |
| LEAP-Seq percent confirming: | 99.6405 |
| LEAP-Seq n confirming: | 1386 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCCACTAAACATTGGGAG |
| Suggested primer 2: | TCCTATCCTGAGCCACATCC |