Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.141054 |
Chromosome: | chromosome 16 |
Location: | 174857 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g695050 | ECH3,HCD1 | (1 of 1) 1.1.1.35//4.2.1.17//5.1.2.3//5.3.3.8 - 3-hydroxyacyl-CoA dehydrogenase / Beta-keto-reductase // Enoyl-CoA hydratase / Unsaturated acyl-CoA hydratase // 3-hydroxybutyryl-CoA epimerase // Dodecenoyl-CoA isomerase / Dodecenoyl-CoA Delta-isomerase; Enoyl-CoA hydratase 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCTGAGAGCTGCGAAAGCGGGGTAGTA |
Internal bar code: | CAGGTGGGAAAGTGCCGTGTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 789 |
LEAP-Seq percent confirming: | 99.0424 |
LEAP-Seq n confirming: | 724 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGAAGCTCAGAAGGAGTTG |
Suggested primer 2: | CACACACCCACAAACACACA |