| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.141059 |
| Chromosome: | chromosome 1 |
| Location: | 937379 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g005150 | SGA1 | Serine glyoxylate aminotransferase; (1 of 1) 2.6.1.44//2.6.1.45//2.6.1.51 - Alanine--glyoxylate transaminase / Alanine--glyoxylate aminotransferase // Serine--glyoxylate transaminase / SGAT // Serine--pyruvate transaminase / Serine--pyruvate aminotransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCAATCCGAAGCGCCCGGGTGTGCCCAC |
| Internal bar code: | CCGGACCGAGCGGGGGCGCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 879 |
| LEAP-Seq percent confirming: | 99.872 |
| LEAP-Seq n confirming: | 5460 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGCGGGTGTTAGGAGATG |
| Suggested primer 2: | ACCGCAAGGAAGTTAAGGGT |