Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.141107 |
Chromosome: | chromosome 8 |
Location: | 3634936 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g376300 | LIL5, SEP2 | Stress Enhanced Protein 2; (1 of 45) IPR023329 - Chlorophyll a/b binding protein domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCACGGGGCAGGCAAAGGATGCGGATT |
Internal bar code: | GCGGGGGCGATAGTGCTCCAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 918 |
LEAP-Seq percent confirming: | 99.6564 |
LEAP-Seq n confirming: | 580 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCAGTAGGGCAGCACTCTT |
Suggested primer 2: | GAAGCAGATAGGCAGGTTCG |