| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.141182 |
| Chromosome: | chromosome 1 |
| Location: | 2221857 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g012150 | FKB16-10,MSRA4 | Peptide methionine-S-sulfoxide reductase, msrA-type; (1 of 1) 1.8.4.11//5.2.1.8 - Peptide-methionine (S)-S-oxide reductase / Peptide methionine sulfoxide reductase // Peptidylprolyl isomerase / Rotamase | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAGTACGAGTAGGATGGATGGAAGCCGC |
| Internal bar code: | CGACCATAGCGTCGCCACCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 402 |
| LEAP-Seq percent confirming: | 99.658 |
| LEAP-Seq n confirming: | 2331 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACATCGCAACACCGGATAA |
| Suggested primer 2: | CCGCCCACTGAACGTACTAT |