Insertion junction: LMJ.RY0402.141241_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.141241
Chromosome:chromosome_8
Location:4149075
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CACAGACGCAAGCACCTCAGATGCACACAC
Internal bar code:CTTCGGCTCAAGAAGAACTATA

Confirmation - LEAP-Seq

LEAP-Seq distance:188
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:520
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:GTTTCCTAGGATGCTGCGAG
Suggested primer 2:CAGGAGTCGTAGAAGTCGCC