| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.141281 |
| Chromosome: | chromosome 9 |
| Location: | 1699543 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396950 | MFT25,CGL15,PHT4I,PHT4-9 | Na+-dependent inorganic phosphate cotransporter; (1 of 4) K08193 - MFS transporter, ACS family, solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), other (SLC17A) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATATGGAGCTACTCCCGGTCCTGTTTGC |
| Internal bar code: | AAGCTAGCTACGCGGGTCGGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 919 |
| LEAP-Seq percent confirming: | 99.8855 |
| LEAP-Seq n confirming: | 1745 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCGCACACCACCTCATAC |
| Suggested primer 2: | CTGCAATGGTGACGAGCTAA |