| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.141313 |
| Chromosome: | chromosome 5 |
| Location: | 3022291 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238500 | (1 of 4) K06941 - 23S rRNA (adenine2503-C2)-methyltransferase [EC:2.1.1.192] (rlmN) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTCCAGGAAGTGTTGCAGCTGCGGCAGC |
| Internal bar code: | TCGTCCTGTACATCCGTGTCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 710 |
| LEAP-Seq percent confirming: | 98.7003 |
| LEAP-Seq n confirming: | 51945 |
| LEAP-Seq n nonconfirming: | 684 |
| LEAP-Seq n unique pos: | 87 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCTGAGCCACGATACAGA |
| Suggested primer 2: | GTGACTACGGTTTCCACGGT |