| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.141378 |
| Chromosome: | chromosome 7 |
| Location: | 5374986 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g350100 | (1 of 1) IPR000104//IPR006311//IPR017956//IPR026741//IPR026937//IPR027417 - Antifreeze protein, type I // Twin-arginine translocation pathway, signal sequence // AT hook, DNA-binding motif // Protein strawberry notch // Strawberry notch, helicase C domain // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAAGCAAGCCGTACTGGCGGAAAGGGGAT |
| Internal bar code: | TTTATGGCCTAGGTCGCTAAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 649 |
| LEAP-Seq percent confirming: | 99.2689 |
| LEAP-Seq n confirming: | 1222 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTTTCACCCTCCTCTACC |
| Suggested primer 2: | TCCCCCTCTACACACACACA |