| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.141403 |
| Chromosome: | chromosome 16 |
| Location: | 1524741 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g653300 | BLZ19 | bZIP transcription factor; (1 of 21) IPR004827 - Basic-leucine zipper domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGAATGGGGGACGGGTCCCATCGGAGGG |
| Internal bar code: | ATCAATTGCGCCCCAGGCAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 190 |
| LEAP-Seq percent confirming: | 96.0 |
| LEAP-Seq n confirming: | 120 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGAAGTCAAACCTTGTGGT |
| Suggested primer 2: | ACATGTCTCCCAAGCCTACG |