Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.141488 |
Chromosome: | chromosome 6 |
Location: | 7233083 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g298100 | SUI1A,SUI1 | Translation initiation protein; (1 of 1) K03113 - translation initiation factor 1 (EIF1, SUI1) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGACCCGCGGCGTTGACGTTCTTCACAA |
Internal bar code: | ACGTCACGGGTTGCGGCAATGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 785 |
LEAP-Seq percent confirming: | 99.5726 |
LEAP-Seq n confirming: | 233 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGAGCTGTCCTAGAACCTG |
Suggested primer 2: | AAAGAAAAGCAAACGGCTCA |